Review



grna cas9 expression vector made in  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc grna cas9 expression vector made in
    Grna Cas9 Expression Vector Made In, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 4079 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/bio_rxiv__64898__2026__03__27__714694-254-9-21
    Average 96 stars, based on 4079 article reviews
    grna cas9 expression vector made in - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Injection:

    Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes
    Article Snippet: .. To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Cas9 expression vector (pHsp70-Cas9; #45945, Addgene). ..

    Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes.
    Article Snippet: .. Generation of WFS1 KO, UAS-dCISD, and UASdCISD peptide flies To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Cas9 expression vector (pHsp70-Cas9; #45945, Addgene). ..

    Sequencing:

    Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes
    Article Snippet: .. To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Cas9 expression vector (pHsp70-Cas9; #45945, Addgene). ..

    Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes.
    Article Snippet: .. Generation of WFS1 KO, UAS-dCISD, and UASdCISD peptide flies To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Cas9 expression vector (pHsp70-Cas9; #45945, Addgene). ..

    Expressing:

    Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes
    Article Snippet: .. To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Cas9 expression vector (pHsp70-Cas9; #45945, Addgene). ..

    Article Title: An efficient low cost means of biophysical gene transfection in primary cells.
    Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Cas9 expression vector (Addgene #52961). ..

    Article Title: Reciprocal rescue of Wolfram syndrome by two causative genes.
    Article Snippet: .. Generation of WFS1 KO, UAS-dCISD, and UASdCISD peptide flies To generate WFS1 KO flies, we injected w1118 fly embryos with a pU6-Bbs1-chiRNA vector (#45946, Addgene) containing the 20-bp sgRNA sequence (GCTCACCAGGCGTCATAGCC), along with the Cas9 expression vector (pHsp70-Cas9; #45945, Addgene). ..

    Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment.
    Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes.

    Article Title: Identification of stress specific autophagy regulators from tandem CRISPR screens
    Article Snippet: sgRNA pairs targeting genes of interest were selected from the transEDIT-dual CRISPR Whole Genome Arrayed Library (Transomic Technologies, Huntsville, AL). .. They were used in conjunction with a Cas9 expression vector containing neomycin (G418) resistance transcript (Addgene #98292). ..

    Article Title: An efficient low cost means of biophysical gene transfection in primary cells
    Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Cas9 expression vector (Addgene #52961). ..

    Article Title: Pancreatic alpha and beta cell fate choice is directed by apical-basal polarity dynamics.
    Article Snippet: EZR-mKATE2/NEUROG3-EGFP double reporter cell line: The EZR sequence, including 1,000 bp homology arms, was amplified from human genomic DNA and cloned into a pBluescriptSK vector backbone using Seamless cloning (Thermo Fisher) to generate the EZR-mKATE2 fusion cassette. .. Two guide-RNA sequences targeting the EZR locus were cloned into a Cas9 expression vector (pX458-HF1, Addgene #48138) and co-transfected. .. Plasmids (1-5 mg/106 cells) were transfected into hESCs by the P3 Primary Cell Kit (Lonza) using the CA137 program on the Lonza 4D-Nucleofector.

    Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology
    Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a Cas9 expression vector (Addgene 49330 [ ]). .. OSCs were co-transfected with the verified donor and sgRNA/Cas9 plasmids using the Amaxa 4D nucleofection system (buffer SF, program DG150).

    CRISPR:

    Article Title: An efficient low cost means of biophysical gene transfection in primary cells.
    Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Cas9 expression vector (Addgene #52961). ..

    Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment.
    Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes.

    Article Title: An efficient low cost means of biophysical gene transfection in primary cells
    Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Cas9 expression vector (Addgene #52961). ..

    Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology
    Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a Cas9 expression vector (Addgene 49330 [ ]). .. OSCs were co-transfected with the verified donor and sgRNA/Cas9 plasmids using the Amaxa 4D nucleofection system (buffer SF, program DG150).

    Clone Assay:

    Article Title: An efficient low cost means of biophysical gene transfection in primary cells.
    Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Cas9 expression vector (Addgene #52961). ..

    Article Title: An efficient low cost means of biophysical gene transfection in primary cells
    Article Snippet: .. To create sgRNA expressing CRISPR plasmids, CRISPR RNA (crRNA) sequences were cloned into a tracrRNA containing Cas9 expression vector (Addgene #52961). ..

    Article Title: Pancreatic alpha and beta cell fate choice is directed by apical-basal polarity dynamics.
    Article Snippet: EZR-mKATE2/NEUROG3-EGFP double reporter cell line: The EZR sequence, including 1,000 bp homology arms, was amplified from human genomic DNA and cloned into a pBluescriptSK vector backbone using Seamless cloning (Thermo Fisher) to generate the EZR-mKATE2 fusion cassette. .. Two guide-RNA sequences targeting the EZR locus were cloned into a Cas9 expression vector (pX458-HF1, Addgene #48138) and co-transfected. .. Plasmids (1-5 mg/106 cells) were transfected into hESCs by the P3 Primary Cell Kit (Lonza) using the CA137 program on the Lonza 4D-Nucleofector.

    Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology
    Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a Cas9 expression vector (Addgene 49330 [ ]). .. OSCs were co-transfected with the verified donor and sgRNA/Cas9 plasmids using the Amaxa 4D nucleofection system (buffer SF, program DG150).

    Transfection:

    Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment.
    Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes.

    Plasmid Preparation:

    Article Title: CRISPR knockout screens reveal genes and pathways essential for neuronal differentiation and implicate PEDS1 in neurodevelopment.
    Article Snippet: Neurodevelopmental disorders (NDDs) arise from disruptions in brain development, yet the underlying pathways remain incompletely understood.. Here we demonstrate that genome-wide CRISPR knockout screens in mouse embryonic stem cells differentiating into neural lineages identify hundreds of essential genes, only a minority of which are currently implicated in NDDs.. Dominant NDD genes were enriched for transcriptional regulators, whereas recessive NDD genes were predominantly involved in metabolic processes.

    Article Title: Pancreatic alpha and beta cell fate choice is directed by apical-basal polarity dynamics.
    Article Snippet: EZR-mKATE2/NEUROG3-EGFP double reporter cell line: The EZR sequence, including 1,000 bp homology arms, was amplified from human genomic DNA and cloned into a pBluescriptSK vector backbone using Seamless cloning (Thermo Fisher) to generate the EZR-mKATE2 fusion cassette. .. Two guide-RNA sequences targeting the EZR locus were cloned into a Cas9 expression vector (pX458-HF1, Addgene #48138) and co-transfected. .. Plasmids (1-5 mg/106 cells) were transfected into hESCs by the P3 Primary Cell Kit (Lonza) using the CA137 program on the Lonza 4D-Nucleofector.

    Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology
    Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a Cas9 expression vector (Addgene 49330 [ ]). .. OSCs were co-transfected with the verified donor and sgRNA/Cas9 plasmids using the Amaxa 4D nucleofection system (buffer SF, program DG150).

    Synthesized:

    Article Title: The Drosophila OSC Genome: A Resource for Studies of Transposon and piRNA Biology
    Article Snippet: .. A CRISPR-Cas9 sgRNA targeting the chosen insertion site within the flamenco upstream region (target: TATAAAAGTTACAAAATACG) was designed using CHOPCHOP, synthesized as complementary oligonucleotides, and cloned into a Cas9 expression vector (Addgene 49330 [ ]). .. OSCs were co-transfected with the verified donor and sgRNA/Cas9 plasmids using the Amaxa 4D nucleofection system (buffer SF, program DG150).



    Similar Products

    96
    Addgene inc grna cas9 expression vector made in
    Grna Cas9 Expression Vector Made In, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/bio_rxiv__64898__2026__03__27__714694-254-9-21
    Average 96 stars, based on 1 article reviews
    grna cas9 expression vector made in - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc crispr cas9 expression vector pspcas9 bb 2a gfp
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Crispr Cas9 Expression Vector Pspcas9 Bb 2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/bio_rxiv__64898__2026__03__10__710185-144-14-19
    Average 96 stars, based on 1 article reviews
    crispr cas9 expression vector pspcas9 bb 2a gfp - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc expression vectors pet28a cas9 his
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Expression Vectors Pet28a Cas9 His, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/pET28a-Cas9-His+(Plasmid+%2398158)/pm41776280-211-0-3
    Average 93 stars, based on 1 article reviews
    expression vectors pet28a cas9 his - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    Addgene inc bicistronic expression vector px330 cas9
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Bicistronic Expression Vector Px330 Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/pm41708849-481-1-5
    Average 96 stars, based on 1 article reviews
    bicistronic expression vector px330 cas9 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc cas9 expression vector pspcas9 bb 2a gfp
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Cas9 Expression Vector Pspcas9 Bb 2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pmc12867480-300-18-27
    Average 96 stars, based on 1 article reviews
    cas9 expression vector pspcas9 bb 2a gfp - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Addgene inc expression vector
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/pST1374-NLS-flag-linker-Cas9+(Plasmid+%2344758)/pmc12911573-45-13-16
    Average 95 stars, based on 1 article reviews
    expression vector - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Addgene inc pet15b expression vector
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Pet15b Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/SP-Cas9+(Plasmid+%2362731)/pmc12901986-317-11-14
    Average 96 stars, based on 1 article reviews
    pet15b expression vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc cas9 expression vector
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Cas9 Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/lentiCas9-Blast+(Plasmid+%2352962)/pm41491239-282-17-21
    Average 96 stars, based on 1 article reviews
    cas9 expression vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc cas9 grna dual expression vector
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Cas9 Grna Dual Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cas9+expression+vector/px459V2%2E0_Conc2+(Plasmid+%23134451)/med_rxiv__64898__2025__12__23__25342932-35-5-8
    Average 93 stars, based on 1 article reviews
    cas9 grna dual expression vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Generation of KRAS knockout clones. (A) Schematic of the CRISPR/Cas9 strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.

    Journal: bioRxiv

    Article Title: Baseline cellular state dictates the molecular impact of KRAS mutant variants in pancreatic cancer cells

    doi: 10.64898/2026.03.10.710185

    Figure Lengend Snippet: Generation of KRAS knockout clones. (A) Schematic of the CRISPR/Cas9 strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.

    Article Snippet: A single-guide RNA (sgRNA) targeting KRAS exon 2 (sequence: 5’-AATTACTACTTGCTTCCTGT-3’) was cloned into the CRISPR-Cas9 expression vector pSpCas9(BB)-2A-GFP (PX458, Addgene plasmid #48138).

    Techniques: Knock-Out, Clone Assay, CRISPR, Western Blot, Control